CONSED 9.0 DOCUMENTATION CONTENTS: WHAT IS NEW IN CONSED 9.0 QUICK TOUR OF CONSED ADVANCED PHRAP/CONSED USAGE INSTALLING CONSED NOTE TO SGI USERS FOR PROGRAMMERS AND FELLOW TRAVELLERS ONLY MONITORS AND MICE FOR CONSED PRIMER PICKING PARAMETERS AUTOFINISH PARAMETERS NEW ACE FILE FORMAT WHAT THE COLORS MEAN ---------------------------------------------------------------------------- WHAT IS NEW IN CONSED 9.0 This section is mainly intended for advanced consed users. Novice users should consult the Quick Tour (below). --------------------------------------------------------------------- Note to Linux users: The 'scroll all traces' bug is fixed. Note to Solaris 2.7 users: Consed now works on this version of solaris. --------------------------------------------------------------------- Autofinish Improvements * Reverses (universal primer reverse reads) are now suggested in order to close gaps and improve low quality regions in addition to flanking gaps. * Autofinish now evaluates itself--after you do the reads it suggests, you can run it and it will tell you how well the reads solved the problems they were supposed to solve. * Oligos are tagged (when you use -doExperiments). * doNotFinish tags can be used to tell autofinish to not try to finish particular regions. * There are many more flags, allowing you a great amount of control over autofinish. For example, if you wanted the first round of autofinish to not choose any custom oligo experiments, fine. If you wanted autofinish to only close gaps and not improve the error rate within contigs, fine. * The autofinish output is very detailed and verbose. Thus in addition there are 3 summary lists of experiments to do (one file for forward universal primer experiments, one file for reverse universal primer experiments, and one file for custom oligo walks.) These summary files are easily imported into Excel. You can use the last one to email order oligos. --------------------------------------------------------------------- Consed: * Consed already had the ability to tear a contig into 2 and join 2 contigs into one. Now it also has the ability to move a single read to a different location within an assembly. Now you have much better control in fixing a misassembly. * You used to be able to compare a contigs to one other contig. Now you can compare a contig to many other contigs. * For sites with LONG, LONG read names: you can now customize how much space consed saves for displaying read names. You can also customize the initial size of the important windows. * In the Traces Window, you can move left and right with the arrow keys. * In the Aligned Reads Window, you can instantly move to the beginning and/or end of a read. Similarly, you can move instantly to the beginning and/or end of the consensus. * The ABI base calls can be hidden, if you like, thus allowing you to see more traces at once. * All documentation windows can be searched and printed out. * In the past you could see all tags of a particular type for a particular contig. Now there is also a function to see all tags of a particular type in any contig. * You can now write all contigs to a file in FASTA format with a single click. * You can navigate to multiple locations while staying in the Aligned Reads Window--you don't have to switch windows with each location. * Navigate by single stranded regions and navigate by single subclone regions used to depend on the dim settings to decide whether it counted low quality regions or not. Now these functions do not depend on the dim settings. * For the primers that consed picks, consed will show you the alignment of the closest false match. This will help you in deciding if you want to raise consed.primersMaxMatchElsewhereScore * The template picking part of primer picking has been further improved: ------------------------------------------------- (template) ---> (primer) <----distance to end of template----> This 'distance to end of template' gives the longest read you could possibly make with this primer and this template. If this distance is too short, you can now reject the template. The consed resource to set is: consed.primersWhenChoosingATemplateMinPotentialReadLength: 500 * If you want to pick templates yourself, you can turn off consed's template picking. This is particularly useful if you haven't bothered to customize determineReadTypes.perl * If you are using an old version of phred or if you haven't installed it correctly (with all kinds of bad effects), consed will warn you. * Previously, consed reported the error rate for a contig. But some contigs have long tails of low quality bases and you would like to know the error rate for the contig without that long tail. Now you can do that: You can get the error rate for a specified region. * Programmers can now append RT tags to the ace file. (See FOR PROGRAMMERS AND FELLOW TRAVELLERS in README.txt) * Programmers can popup a trace by a command from a different program. ---------------------------------------------------------------------------- QUICK TOUR OF CONSED Release 9.0 Consed is a program for viewing and editing assemblies assembled with the phrap assembly program. If you are already an advanced consed user, you should read through this and do any of the exercises on features that you are unfamiliar with. I frequently run across people who are doing something in consed a hard way month after month, and request a new feature to make things easier, when that new feature is already in consed. If you have never used consed before, to follow this Quick Tour will take you less than 2 hours. However, it will save you approximately 2 days in agony. If you have 2 extra days to spare, and prefer to waste them in agony, then do not do this Quick Tour and instead immediately skip down to 'INSTALLING CONSED' below. When you do the quick tour, I encourage you to be free about changing the data set. If you really mess things up (such as changing all a read's bases to N's), no problem--just delete the data set and start again with a fresh copy. 1) After downloading the distribution with netscape (see www.phrap.org and click on 'consed'), copy the distribution to a unix computer (if it is not already on one), and then unpack the files by typing the appropriate line below (which one depends on what you named the file downloaded by netscape): zcat consed_solaris.tar.Z | tar -xvf - zcat consed_alpha.tar.Z | tar -xvf - zcat consed_hp.tar.Z | tar -xvf - zcat consed_sgi.tar.Z | tar -xvf - zcat consed_linux.tar.Z | tar -xvf - Note: You must untar on a UNIX computer--not on an NT computer. 2) The only unix commands you must learn are the following 3: pwd -- this tells you were you are ls -- this tells you what files are there (Same as DIR in DOS) cd -- this moves you (Same as CD in DOS) That's it--use them a lot! USING CONSED GRAPHICALLY 3) Type the following: cd standard/edit_dir 4) start consed by typing the appropriate command below: ../../consed_solaris ../../consed_alpha ../../consed_hp ../../consed_sgi ../../consed_linux Two windows will appear. One of these will have the list of .ace files and say 'select assembly file to open' and 'standard.fasta.screen.ace.1'. Double click on that name. The first window goes away. You will now see a list of one contig and a list of reads. This is the 'Main Consed Window'. Double click on 'Contig1'. The 'Aligned Reads Window' will appear. Try scrolling back and forth. Try scrolling by dragging the thumb of the scrollbar. Also try scrolling by clicking on the 4 << < > >> buttons for scrolling by small amounts. For scrolling by tiny amounts, click on the arrows at either end of the scrollbar. For scrolling by huge amounts, use the middle mouse button and just click on some location on the scrollbar. For scrolling to the beginning or end of the contig, use the <<< or >>> buttons. (Question: why can't you just move the scrollbar to the extreme left in order to go to the beginning of the contig? Answer: in typical assemblies, there are reads that protrude beyond the beginning of the contig and reads that protrude beyond the end of the contig. Moving the scrollbar to the extreme left will scroll the contig to the beginning of the leftmost read--typically far to the left of the beginning of the contig. Thus you should get in the habit of using the <<< and >>> buttons.) Notice the colors. The bases that are in red are the ones that disagree with the consensus. Notice the different shades of grey background (around the bases). They have the following meanings, but first, you need to understand the meaning of the quality values: A quality value of 10 means 1 error in ten to the 1.0 power A quality value of 20 means 1 error in ten to the 2.0 power A quality value of 30 means 1 error in ten to the 3.0 power A quality value of 40 means 1 error in ten to the 4.0 power and for quality values in between: A quality value of 25 means 1 error in ten to the 2.5 power Get the idea? (These have actually been empirically verified--if you are interested in the gory details, read the phred papers: Ewing B, Hillier L, Wendl M, Green P: Basecalling of automated sequencer traces using phred. I. Accuracy assessment. Genome Research 8, 175-185 (1998). Ewing B, Green P: Basecalling of automated sequencer traces using phred. II. Error probabilities. Genome Research 8, 186-194 (1998). In that same copy of the journal is a paper about consed, as well.) Also notice the upper and lowercase. This is just a cruder indication of the quality of the bases. 5) To see the quality value of a particular base, point at it and click with the left mouse button. These quality values are shown in grey scales: Quality 0 through 4 is given by dark grey Quality 5 through 9 is given by a shade lighter Quality 10 through 14 is given by a shade still lighter . . . Quality of 40 through 97 is given by white (the brightest shade) A quality value of 99 is reserved for bases that have been edited and the user is absolutely sure of the base ('high quality edited'). A quality value of 98 is reserved for bases that have been edited and the user is not sure of the base ('low quality edit'). The ends of the reads shows bases that are grey and have a black background. These are the low quality ends of the reads or the unaligned ends of reads, as determined by phrap. To see the quality of a base, click on it. You will see the quality displayed in the Info Box on the Aligned Reads Window. 6) Click on a base on a read. Then hold down the control key and type 'a'. You will move to the beginning of the read. Hold down the control key and type 'e'. You will move to the end of the read. (Emacs users will recognize these commands.) 7) Scroll so that location 490 is about in the middle of the aligned reads window. Push the left mouse button down on the menu item 'Dim'. There will be a list of choices that will appear. Drag the cursor down to 'Dim Nothing' and release. Now look what happened to the color of the bases. The ends of the reads that used to be with a black background now appear red with a grey background. You are seeing the clipped-off bases with all the same information as any other base. Since there is a huge amount of red (discrepant) bases, the screen becomes distracting and busy. Thus by default the low quality clipped-off bases are made with a black background and a grey foreground so they don't distract you. Notice there is a distinction here between 'low quality ends of reads' and 'unaligned ends of reads'. Unaligned ends of reads can be low quality as well, or they can be high quality, as in the case of chimeric reads. You can play with the dimming options a bit. Then return it to 'Dim Low Quality' for the rest of this tour. TRACES AND EDITING 8) Point with the mouse at a base of one of the reads and click with the middle mouse button. (If you have a 2 button mouse, see MONITORS AND MICE FOR CONSED below.) The Trace Window showing the traces for that stretch of read should popup. There are 3 rows of bases in the trace window: 'con' is the consensus 'edt' is where you can edit the base calls of the read 'phd' is the original phred base calls Notice that a red rectangle blinks (the 'cursor') in the corresponding positions of the Aligned Reads Window and the Trace Window. 9) Try editing in the Trace Window. You can click the left mouse button on a base in the 'edt' line to set the cursor (a blinking red rectangle). You can directly overstrike a base by typing a letter. Try this. Try undoing it (by clicking on 'undo' ). If you want to undo more than one edit, you will have to go back to the main consed window and click on the button labeled 'Undo Edit...'--you will learn that later. You can move left and right with the arrow keys. We believe that the user should change a base call only while examining the traces. That is why editing is done here--not in the Aligned Reads Window. 10) You can insert a column of pads by pushing the space bar. Try this. (You may need to click on a base on the 'edt' line first.) (For those of you new to editing assemblies, a 'pad', which in consed and phrap is represented by the '*' character, is used to align two or more sequences such as these: gttgacagtaatcta gttgacataatcta in which one sequence has an inserted or deleted base with respect to the other. By inserting the pad character, it is possible to get a good alignment: gttgacagtaatcta gttgaca*taatcta This is the purpose of pad character--it is just a placeholder.) You can then overstrike a pad with a base. In this way you can insert a base, and still preserve the alignment. 11) Try highlighting a stretch of a read on the edt line by holding down the middle mouse button and dragging the cursor over some bases. They will turn yellow as you drag. Then release the mouse button. A window will popup giving you some choices of what to do with those (yellow) bases.: Make High Quality--makes the highlighted bases edited high quality (99). This tells phrap (when it reassembles) that you are sure of the sequence here. Change Consensus--make the highlighted bases edited high quality and change the consensus to agree with that stretch of the read. This is a directive to phrap (upon reassembly) to use that stretch of that read to be the consensus. Make low quality--makes the highlighted bases edited low quality. This tells phrap (when it reassembles) that you are not sure of the bases here and phrap can go ahead and make a join even if the bases in this region don't match perfectly. Make Low Quality to Left End--same as above, but all the way to the left end of the read. Make Low Quality to Right End--same as above, but all the way to the right end of the read. Change to n's--Change the highlighted bases to n's which means they are unknown bases. This tells phrap (when it reassembles) to not make any join based on these bases. It is useful when you believe the bases may be in the chimeric portion of a read. Change to n's to left--same as above but to left end. Change to n's to right--same as above but to right end. Add Comment Tag--allows user to add a comment to a stretch of read bases. Add Tag--allows user to add any tag to a stretch of read bases. Dismiss--you decided you don't really want to do anything with this stretch of bases. This popup is made so that nothing else works until you choose something. Try each of these choices, except for tags, which you'll try below. 'Change Consensus' has an additional function--if a read extends out on the right beyond the end of the consensus, you can extend the consensus by using this function. You might want to do this, for example, if crossmatch did not correctly find the cloning site and thus clipped too much. You can add these bases back to the consensus by using 'Change Consensus'. (You can't try it with this dataset since no read extends beyond the end of the consensus, but you may see this phenomenon with your own data.) 12) To delete a base, overstrike it with a '*' character. (Phrap ignores '*', so this is the same as deleting the character.) If you overstrike all bases in a column with * characters so the entire column consists of *'s (including the consensus base), there is no way to remove the column. This is OK since when you export the consensus (try the exercise on EXPORTING THE CONSENSUS), the *'s are not exported. While you are editing in consed, we believe there should be a visual indication that a base was deleted. SAVING THE ASSEMBLY 13) To save the assembly, pull down the 'File' menu on the Aligned Reads Window, and release on 'Save assembly'. A box will pop up with a suggested name. I suggest you always use the one it suggests. The idea is that the ace files: (project).fasta.screen.ace.1 (project).fasta.screen.ace.2 (project).fasta.screen.ace.3 (project).fasta.screen.ace.4 (project).fasta.screen.ace.5 are in order of how old they are. If you feel you are taking up too much disk space, then start deleting the ace files starting at the oldest. I do not recommend that you overwrite existing ace files. The version numbers just keep growing, and that is not a problem. EXPORTING THE CONSENSUS 14) Exporting the consensus. Bring the Aligned Reads Window into view again. Hold down the left mouse button on the 'File' menu and release the button on 'Export consensus sequence'. Notice that the consensus will be stored (in this case) in a file called 'Contig1.fasta'. Click 'OK'. There is now a file in your edit_dir directory called 'Contig1.fasta' that has the consensus sequence in it. If you want to see the file, bring up another Xterm (if you are UNIX literate), and type: cd standard/edit_dir more Contig1.fasta 15) Fancier exporting the consensus. Bring the Aligned Reads Window into view again. Hold down the left mouse button on the 'File' menu but this time release on 'Export consensus sequence (with options)...'. Just export a little snip of the consensus, from 400 to 410. (You will notice this contains a pad * character.) Ask for both the bases file and the quality file. Click 'OK'. Consed will want to call this file 'Contig1.fasta' again. You can overwrite the existing file. Look in your other Xterm at these files: more Contig1.fasta more Contig1.fasta.qual The one file contains the bases (but no * pads) and the other contains the corresponding qualities of those bases. 16) Exporting the consensus of all contigs at once: Go to the Main Consed Window. Point to 'File', hold down the left mouse button, and release on 'Write all contigs to fasta file'. You then can choose a filename for all contigs to be written to. 17) (For this step, first click on the 'Dim' menu and release on 'Dim Nothing'.) Point to the 'Color' menu, hold down the left mouse button and release on 'Color Means Edited and Tags'. Notice that the bases that you have edited (make sure you have edited some bases) will stand out in either white or grey (depending on whether the base was made high quality or low quality). Observe this both in the Trace Window and the Aligned Reads window. This colormode is useful if you are interested in easily spotting which bases are edited. Return to the 'Color Means Quality and Tags' colormode by the following: point to the 'Color' menu, hold down the left moust button and release on 'Color Means Quality and Tags'. FIND MAIN WINDOW 18) On the Aligned Reads window, click on 'Find Main Win'. This will cause the Consed Main Window to pop up in the event you have buried it under other windows or iconified it. (This may not with some settings of your X emulator. In that case you will have to find and click on the Main Window to bring it up.) MULTIPLE UNDO EDIT 19) Now that the Consed Main Window is visible, click the 'Undo Edit...' button. There will be a popup indicating the most recent edit. Click 'undo'. Then you will see the edit that was done before that. Click 'undo'. You can continue undoing if you like. You now know how to undo more than one edit. You cannot choose which edits to undo and which to not undo--edits can only be undone in precisely reverse order from the order you made them. SCROLLING TRACES AND ALIGNED READS TOGETHER 20) In the Aligned Reads window, scroll along the contig to a different point. Click the left mouse button on a read whose trace is already up. Notice that the existing trace instantly scrolls to the corresponding location. Now go to the Trace Window and scroll the traces to a new location. Click on the edt line with the left mouse button. You will notice that the Aligned Reads window will instantly scroll to the corresponding location. Thus you can keep the Aligned Reads window and the traces scrolled to the same location. EXAMINING ALL TRACES 21) Go to a region where there are lots of reads, say base 1660. Push down the right mouse button and release on 'Display traces for all reads'. You will see all traces displayed in a scrolling window. You can drag the scrollbar on the right down and up to see all the traces. This feature is particularly useful for polymorphism/mutation detection work. This feature was added to work in cooperation with polyphred. To see it in action, exit consed. CONSED-POLYPHRED INTERACTION Polyphred is a program for finding polymorphic sites; it was developed by Debbie Nickerson's group (contact them at http://droog.mbt.washington.edu). We have a test database, 'polyphred', which has had polyphred run on it already. Polyphred has put a polymorphism tag on each polymorphic site. Type: cd ../../polyphred/edit_dir ls ../../consed_(computer type) where (computer type) is one of solaris, hp, alpha, sgi, or linux. Double click on example2.fasta.screen.ace.1 When consed comes up, you should see 2 contigs. Double click on Contig2 In the Aligned Reads Window, push the left mouse button while pointing to the 'Navigate' menu and release on 'Toggle feature: when navigating to consensus location, pop up all traces (currently off)' That will turn this feature on. Now push the left mouse button while pointing to the 'Navigate' menu and release on 'Tags'. Up should pop a list of tag types. Double click on 'polymorphism'. Polyphred has already been run so the consensus is tagged with polymorphism tags at each polymorphic site. Up will pop a window labelled 'Polymorphism Tags' with a list of sites. Click on 'Next'. If you correctly followed the instructions above, all the traces should pop up at the first polymorphic site. You may want to reposition the traces window to see it better. Now ignore the original 'Polymorphism Tags' window and instead click on 'Next' in the *traces* window. This will take you to the next polymorphic site. Pretty nice, huh? After you are done playing with this feature, exit consed and go back to the previous database: cd ../../standard/edit_dir ls ../../consed_(computer type) Double click on standard.fasta.screen.ace.1 Double click on Contig1 to bring up the Aligned Reads Window again in preparation for the next step. NAVIGATING 22) In the Aligned Reads window, pull down the Navigate menu and release on 'Low consensus quality'. You will see a list of locations. Move the 'Low consensus quality' window down so you can see the Aligned Reads window. Repeatedly click on 'Next' until you reach the end of the list. (Low consensus quality means an area in which the bases each have too high probability of being wrong.) This saves you from having to look through large amounts of high quality data trying to find problem areas. Alternatively, you can click on the 'Prev' and 'Next' buttons on the Aligned Reads Window. Thus you can keep the Aligned Reads Window in front with input focus and keep the Low consensus quality window pushed out of the way. You may want to click on the 'Save' button in the Low consensus quality Window to save to a file a copy of this list of problem areas as you work through them. In our experience, this will be the most important navigate list you will use. In fact, finishing consists mainly of adding reads and rephrapping until this list is reduced to nothing. 23) Dismiss the Low consensus quality window. Pull down the 'Navigate' menu again and release on 'High quality discrepancies as above, but omitting tagged compressions and G_dropouts'. You will probably notice there are no entries (unless you created some yourself by editing). That is because there are no high quality discrepancies with this dataset. So let's force there to be some by lowering the quality threshold. First, dismiss the High quality discrepancies window. Click on 'Find Main Win'. In the main consed window, pulldown the 'Options' menu and release on 'General Preferences'. Notice that the default for 'Threshold for High Quality Discrepancy' is 40. Change it to 15 and click 'Apply & Dismiss'. Then follow the steps above to bring up the High quality discrepancies menu. Now you will see several entries. Click 'next' repeatedly to go successively to the next high quality discrepancy in the Aligned Reads Window. You can also double click on a particular line in the High quality discrepancies window to go to that location. Alternatively, you can single click on a line and then click the 'Go' button. Dismiss the High quality discrepancies window. 24) Similarly, try the other navigate lists: Unaligned high quality regions (this list will be empty with this data set), Edits, Regions covered by only 1 strand and only 1 chemistry, and Regions covered by only 1 subclone. Unaligned high quality regions are regions in which the traces are high quality so there is no question of the bases, but the region differs so much from other reads that phrap has given up trying to align the region with the consensus. This could be due to a chimeric read, or perhaps the read belongs somewhere else. We believe that regions covered by only 1 subclone should be covered by a 2nd subclone to prevent the possibility of there being a deletion in the single subclone. There are so many different problem lists that you may forget to check one of them and thus miss a serious problem. Thus we combined them all into a single list. This is the first menu item: 'Low Cons/High Qual Discrep/Single Stranded/Single Subclone/Unaligned High'. We suggest you use this list. 25) Also try navigate by tags by selecting 'tags' under navigate: when the Select Tag Type Window appears, double click on 'compression'. (Note that you can't do anything else until you deal with this window.) This gives a list of a particular tag type in a particular contig. 26) There is also a way of getting a list of a particular tag type in all contigs: Click on 'Find Main Win'. In the Main Consed Window, point to the 'Navigate' menu, hold down the left mouse button, and release on 'Tags in all contigs'. Continue as in the previous step. PRIMER-PICKING To do this step, you must have first completed the INSTALLING CONSED (below). So, if you haven't done that yet, please complete that first. 27) Go to some location near the right end of the contig, say base 2570. Click with the right mouse button on the consensus and click on either one of the top strand primer choices (either from subclone template or from clone template). Consed will pause a moment, and then there will appear a selection of primers that pass all of consed's requirements. Templates are also chosen for each primer. You may have to scroll the primer list to the right to see the templates. Consed lists these templates in order of quality--all of them will cover the read you want to make. Double click on one of the primers in the Primers Window. That will cause the Aligned Reads Window to scroll to show that oligo in context. Click on 'Accept Primer'. Notice that a yellow oligo tag is created on the consensus for that primer. That tag contains all the information you need to order that oligo and do the reaction--you will learn how to pop it up below under 'tags'. What is the difference between 'Pick Primer from Subclone Template' and 'Pick Primer from Clone Template'? There are 3 differences: A. which vector file the primers are screened against. In the former case, the primer is screened against the file primerSubcloneScreen.seq and in the latter case against the file primerCloneScreen.seq B. In checking for false matches elsewhere in the assembly, if the template is the whole clone, then consed must check for false matches in the *entire* assembly, including all other contigs. But if the template is just going to be a subclone, consed only needs to check elsewhere in that subclone. Actually, to be conservative, consed checks for false matches +/- the maximum insert size of a subclone. C. If you are picking primers for subclone template, then the primer picker can also pick the subclone templates. If it doesn't find any suitable subclone template, it will reject the primer. (By default, picking of subclone templates is turned off. You can turn it on temporarily or permanently. To turn it on temporarily, go to the Consed Main Window, point to the Options menu, hold down the left mouse button and release on 'Primer Picking Preferences'. Scroll down to 'Pick Subclone Templates for Primers' and click 'True'. Click on 'Apply and Dismiss'. To change this permanently, see CONSED CUSTOMIZATION below. Beware: you must correctly customize determineReadTypes.perl for template picking to work. See INSTALLING CONSED below.) If you are interested in the details of primer-picking, see the section 'PRIMER PARAMETERS' (below). When you are done editing and have saved the assembly and exited consed, run ace2Oligos.perl (supplied with this distribution--make sure your system administration installed it) which will extract all the oligos you just created. This is handy for email ordering of oligos. In the xterm, type: ace2Oligos.perl standard.fasta.screen.ace.2 oligos.txt where standard.fasta.screen.ace.2 is whatever the name is of the ace file you just saved. SEARCH FOR STRING 28) Try the 'Search for String' button (left side of the Aligned Reads Window). Type in a string (such as aaaca), and click 'ok'. There should be a list of 'hits'. Double click on one of the hits (or single click on it and click on 'go'.) Notice that the Aligned Reads Window scrolls to that position and has the cursor on the found string. (It might be complemented.) Dismiss this window. Try this again, only this time in the Search For String Window select 'Search Just Reads'. Then click 'OK'. You will notice there are many more hits. This is because this shows hits in each read, even if they are at the same consensus position. COPY AND PASTE 29) In the Aligned Reads Window, swipe some bases by holding down the left mouse button. You should see the bases turn yellow, at least temporarily. Then click the 'Search for String' button. Use the middle mouse button to paste the bases you have just swiped into the 'Query string:' box. Notice that you can swipe bases either from the consensus or from a read. The search for string is case-insensitive so don't worry about the pasting being upper or lowercase. CORRECTING FALSE JOINS MADE BY PHRAP 30) Phrap may put several reads together that you believe do not belong together. (For example, you may see several high quality discrepancies between the reads.) If you are sure these reads do not belong together, you can force a subsequent reassembly by phrap to not assemble those reads together. You do this by finding a location where there is a high quality discrepancy. Then click on the read with the right mouse button and release on 'Tell phrap not to overlap reads discrepant at this location'. There are no high quality discrepancies with this dataset so consed won't let you do this. (Try it and see.) However, when you use your own data, you may get the chance! ADDING READS 31) For this to work, your system administrator must have set up everything correctly. (See below in INSTALLING CONSED.) Assuming you have set everything up correctly, you can now experiment with adding reads. Now bring up consed again using ace file standard.fasta.screen.ace.1 If it asks if you want to apply edits, just say 'no'. On the Main Window, click on the Add New Reads button. There will appear a list of files ending with .fof. These are files that contain lists of chromatograms. Double click on 'reads_to_add.fof' There should be lots of progress output in the xterm from which you started consed. When it completes, there will be a Reads Added Window popup with a report of which reads were added. In this case, it should say that 9 reads were successfully added and list them. TEARS AND JOINS 32) When phrap really screws up, you may want to just tear the contig apart in several places and then join the pieces back together in a different way. Although we discourage you from doing this, we do give you the power to do it, if you want to. Let's try it: Go to location 1550. Point the mouse at the consensus base at 1550 and push the right mouse button down. Release the button on 'Tear Contig at This Consensus Position'. Up will pop a list of reads with 2 little buttons next to them <- and ->. Leave everything as it is and just click 'Do Tear'. (If you want to play around with which reads goes into which contig, do that another time.) Now you should have 2 Aligned Reads Windows on top of each other. One should contain 'Contig2' and the other 'Contig3'. Now let's join these 2 contigs back together: Click on 'Search for String' and type in the following bases: agctgccatc Click 'OK'. Search for string should find 2 locations, one in Contig2 and one in Contig3: Contig2 (consensus) 1447-1456 (uncomplemented) Contig3 (consensus) 829-838 (uncomplemented) Double click on the first one. The Aligned Reads Window for Contig2 will scroll to location 1447 and the window will raise up. In that Aligned Reads Window, click on 'Compare Cont'. Now double click on the 'Contig3' line in the above Search for String results. The Aligned Reads Window for Contig3 will scroll to location 829 and lift up. In that Aligned Reads Window, click on 'Compare Cont'. Now the Compare Contigs Window should be visible. In the Compare Contigs Window, try scrolling back and forth. You can change the cursors (blinking red), but if you do, please return them to the locations 1447 and 829 for the next step. The cursors 'pin' these bases together when doing an alignment. (The algorithm is a pinned Smith-Waterman alignment.) Click on Align. Try scrolling the alignment by dragging the thumb in the lower half of the Compare Contigs. An 'X' means there is a discrepancy between the 2 contigs. There is also a 'P' (see if you can find it!) The P indicates the bases that you pinned together. Click with the left mouse button on either contig in the bottom alignment. You will notice that both contigs will have the red blinking cursor in the same position. Click on 'Scroll Both Aligned Reads Windows' and look at the Aligned Reads Windows to see that they scroll to the corresponding positions. You can have traces up for the contigs, and they will scroll as well. Experiment with this. Then click 'Join'. The 2 previous Aligned Reads Windows will disappear and there will be a new one which has a new contig 'Contig4'. You have made a join! It is possible to have more than one Compare Contigs windows up at a time. This allows you to investigate a repeat that has more than 2 copies. Compare Contigs is one method of exploring joins of contigs that were not made by phrap. Another method is to use phrapview, supplied with phrap. phrapview gives a high level view of all internal joins while 'compare contigs' shows the alignment of a single internal join. Some users have found them to work well together--phrapview to find a join and, having found it, 'compare contigs' to examine it in more detail. REMOVING READS 33) You can also remove individual reads and put them into their own contigs. For example, in the Aligned Reads Window, go to location 2000. Point to the read name of read djs74_2664.s1 and hold down the right mouse button. Release on 'Put read djs74_2664.s1 into its own contig.' Consed will ask you 'Are you sure...?' Answer 'yes'. Presto-chango! The read is put into its own contig and the old contig is redrawn without the read in it. At this point you should save the assembly--you should always save the assembly after removing a read. TAGS 34) Bring up a trace for a read (as above). Swipe some bases on the 'edt' line with the middle mouse button. A list of choices will popup. Select 'Add Comment Tag'. Type in a comment in the box that appears, and click 'OK'. You will now see a blue box both in the Aligned Reads Window and in the Traces Window on that read. To see the comment, you can click on that blue tag in the Aligned Reads Window with the right mouse button and release on 'Tag: comment Show more info?'. Alternatively, you can click on the blue tag in the Traces Window with the right mouse button. Try creating some other kinds of tags: again swipe some bases in the Trace Window. But this time instead of clicking 'Add Comment Tag', click on 'Add Tag'. Select another tag type. You will notice that different tags are in different colors. You can always click with the right mouse button on the tag (as above) if you forget what a particular color means. You can also define your own tag types. See below CREATING CUSTOM TAG TYPES for how to do that. 35) You can create really, really long tags as follows: Just create a short version of the tag as above for where you want the tag to start. Then figure out the consensus position of where you want the tag to end. In the Aligned Reads Window, click on the short tag with the right mouse button and release on 'tag: show more info?' (as above). A Tag Window will appear for that tag. In the Tag Window, simply change the End Unpadded Consensus Position to the place you want it to end. Then click 'OK'. You will now notice that the tag will be as long as you wanted. 36) You can create tags on the consensus in the same way. In the Aligned Reads Window, use the middle mouse button to swipe some bases on the consensus in the Aligned Reads Window. Up will pop a list of tag types. Click on one of them. Try it again somewhere else. Try it with the tag type being 'comment'. In this case, you must enter a comment. Notice the pretty colors! If you forget what a particular color means, you can click on the colored tag with the right mouse button and it will tell you. 37) Try creating some tags that overlap each other. You will notice that the overlapping region will be purple. If you want to know which tags overlap, you can click with the right mouse button on the purple and you will be told all tags that are on that base. 38) If you have many tags that overlap and thus are purple, you can hide some less relevant tag types so there is less purple and there is less distraction. Make sure you have a few tags visible. Then click on 'Find Main Win'. In the Main Window, open the Options menu, and release on 'Hide Some Tag Types'. A list of tag types will popup. Select the type that you have visible (above). Then click 'OK'. Go back to the Aligned Reads Window. That tag should still be visible. Click on the button 'Some Tags' in the upper right part of the Aligned Reads Window. Your tag should disappear. The 'Some Tags' button should have changed to 'Sh All Tags'. Click on it again. Your tags should have reappeared. INCREMENTAL SEARCH FOR READ NAME 39) Restart consed. Instead of clicking on a read or contig name, type a read name into the 'Find read:' box. Try typing djs74_2 You will notice that as you type each letter, the first item in the list that matches the letters typed will be highlighted. Experiment with deleting a few letters and typing others. This is a powerful method of quickly getting to the read name you are interested in. When you get to the read you want, just type carriage return or click the 'OK' button. ONLINE DOCUMENTATION 40) On the Aligned Reads Window, click on the 'Help' menu and release on 'Show Documentation'. You will see this document. GOTO POSITION 41) In the Aligned Reads Window, click in the 'Pos:' box in the upper right-hand corner. Type in a number, such as 540, and push the 'Return' or 'Enter' key. The Aligned Reads Window will scroll to position 540. We find this feature is particularly useful when one person wants another person to look at something in the sequence. HIGHLIGHTING READ NAMES 42) In the Aligned Reads Window, click on a read name with the left mouse button. The name will turn magenta. Click again and it will turn yellow again. Try turning it magenta and then scrolling. This feature is helpful in keeping track of a particular read as you scroll. COMPLEMENTING THE CONTIG 43) Push 'Comp Contig' in the Aligned Reads Window to complement the contig. This displays the opposite strand of the contig including the consensus and all reads. Push this button again to uncomplement it. RECOVERY FROM CRASHES 44) It is important to feel that your data are safe, even if the computer (or consed) were to crash. Consed will recover your data from such a crash. Make an edit (remember, edits are made in the Trace Window) and jot down its location. Also note the name of the ace file which is displayed in the upper left box in the Aligned Reads Window. Then simulate a crash by going to the xterm where you started consed and typing control-C. Restart consed and select the same ace file you noted (above). A box will come up saying 'There is an edit history (a .wrk file) Consed may have crashed during a previous session with this same file. Do you want to apply those edits?' Click on 'yes'. Go and find the edits you made before consed crashed--you will find them. This is the purpose of the .wrk files--they are a log file of your edits and they are added to as you make edits. 45) You should save your edits by pulling open the 'File' menu on the Aligned Reads Window, and releasing on 'Save assembly'. PROTEIN TRANSLATION AND OPEN READING FRAMES 46) If you would like, you can see the amino acid translation of the consensus in all reading frames. In the Aligned Reads Window, push down the left mouse button on the 'Misc' menu and release on 'Show Top Strand Protein Translation'. Try again but this time release on 'Show Bottom Strand Protein Translation'. Notice that there are 2 characters that are in magenta color. What are those characters? Why are they made in a different color? To not show the protein translation, push down the left mouse button on the 'Misc' menu and release on 'Don't show protein translation'. 47) You can search for open reading frames within a contig. In the Aligned Reads Window, push the left mouse button on 'Navigate' and release on 'Search for Open Reading Frames'. Notice that the open reading frames are shown for all 6 reading frames and are sorted by length. ERROR RATE 48) In the Aligned Reads Window is a box (upper right) labelled 'Err/10kb'. This is the estimated error rate for this contig, and it is a good indicator of when you are done (or not done) finishing. In addition, you can find the error rate for a particular region of contig as follows: Point at 'Misc' menu, hold down the left mouse button, pull down and release on 'Show Error Info For Region'. Fill in the boxes for left and right consensus position, click on 'Calculate' and you will be given the error and single subclone data for that region. RUNNING PHRED and PHRAP phred and phrap *must* be run via the phredPhrap perl script. If you don't do this, you are on your own. If you run phred on its own, and then you run phrap on its own, you will get an ace file that will not be usable by consed. If you try to run phred and phrap without using the phredPhrap script, you are on your own. After you have run into problems (and you probably will), then do not email us--instead please use the phredPhrap script. To use the phredPhrap script to run phred and phrap: 49) Type: phredPhrap -V It should say: 991019 If it does not, then you probably have not installed all the perl scripts from the scripts directory, as directed in INSTALLING CONSED. 50) Make a copy of the standard dataset. E.g., cp -r standard test cd test 51) Delete all the file in phd_dir and edit_dir: rm phd_dir/* rm edit_dir/* 52) cd edit_dir 53) Run phredPhrap by typing phredPhrap That's it--you no longer need to type *any* arguments, and generally you should not. (Please do *not* use the -notags option any longer.) If you want to add phrap options, you can do that: e.g., phredPhrap -forcelevel 3 Then run consed on the resulting ace file as indicated in the beginning of the Quick Tour (above). If you have any problems, this is the time to diagnose them before you use your own data. After you have done this successfully, you are ready to use your own data. AUTOFINISH Note: Before you use autofinish on your own data, you must modify determineReadTypes.perl. See INSTALLING CONSED below for information about this. 54) cd to autofinish/edit_dir 55) Try starting consed by typing: ../../consed -autofinish -ace autofinish2.fasta.screen.ace.2 (Note 'consed' above may be 'consed_solaris', 'consed_alpha', 'consed_hp', 'consed_sgi', or 'consed_linux' depending on your executable. If you have trouble, use that 'ls' command (see above)! ) If autofinish says: Run-time exception error; current exception: InputDataError No handler for exception. Abort that means that you have not followed the instructions under 'INSTALLING CONSED' below. Please follow those instructions and then try this again. Consed will create 5 files: autofinish.fof (project name).991014.155627.out (project name).991014.155627.univForwards (project name).991014.155627.univReverses (project name).991014.155627.customPrimers The '991014.155627' is the date and time in format YYMMDD.HHMISS. The first file, autofinish.fof, is a file of filenames. It contains the names of the other files. The .out file is the autofinish output file. If you want to know *why* autofinish picked the reads it did, it will tell you. It will tell you lots more, such as the orientation of the contigs. If you correctly installed consed, it will print out a list of experiments you should do to make reads in order to reduce the number of errors below a target threshold. (project name).991014.155627.univForwards is the summary file of the suggested universal forward subclone reads (project name).991014.155627.univReverses is the summary file of the suggested universal reverse subclone reads (project name).991014.155627.customPrimers is the summary file of the suggested custom primer reads These are the files you will typically use for directing your bench work. If you like, you can import these files into Excel since the fields are separated by commas. This finishing tool is designed to be run in batch after each assembly. In a high throughput operation, the production people can make these reads without anyone using consed to examine the assembly interactively. Only when autofinish cannot help you any longer (either it reduces the number of expected errors below your error threshold, or it says it can't help you further), must you bring up consed graphically and examine the assembly. AUTOFINISH TARGET ERROR RATE Now let's experiment with some of the autofinish options. By default, autofinish will suggest finishing reads until the error rate is less than 100 errors per megabase. Suppose you want fewer errors. Fine: 56) Create a file in edit_dir called .consedrc and put the following line in it: consed.autoFinishMaxAcceptableErrorsPerMegabase: 10 (Note: I have put the following already in your .consedrc consed.autoFinishAllowWholeCloneReads: false That tells autofinish to not suggest any sequencing reactions directly off the BAC or cosmid, since most labs don't like these sequencing reactions--they prefer sequencing reactions off M13 or plasmids. So I suggest you leave this line the way it is.) Run autofinish again the same as before: ../../consed -autofinish -ace autofinish.fasta.screen.ace.1 You will notice two differences in the output: First, near the top of the autofinish output file it will say: consed.autoFinishMaxAcceptableErrorsPerMegabase: 10 whereas before it said: consed.autoFinishMaxAcceptableErrorsPerMegabase: 100 A second difference is that this time it suggested additional experiments. Note for UNIX novices: Earlier, I said that you only needed to know 3 UNIX commands: pwd, ls, and cd. Now I want you to learn one variant: ls -tlr This is the same as ls, but it puts one file on a list and prints the lines so that the most recent files are on the bottom. Since you will be created many, many files as you work through these autofinish exercises, this command gives an easy way to see the files you have just created, without having to always look at autofinish.fof to look for the names of the files you just created. AUTOFINISH: CHANGING COSTS 57) Now please change it back to consed.autoFinishMaxAcceptableErrorsPerMegabase: 100 or else just comment out the line by putting a '!' in the first column like this: !consed.autoFinishMaxAcceptableErrorsPerMegabase: 10 and run autofinish again: ../../consed -autofinish -ace autofinish.fasta.screen.ace.1 Check that it now says: consed.autoFinishMaxAcceptableErrorsPerMegabase: 100 near the top of the autofinish output file. Notice that it calls 3 custom primer subclone sequencing reactions and 3 universal primer sequencing reactions. Suppose you want to indicate that your lab can make oligos very cheaply--as cheaply as doing a universal primer reaction. You can do this by lowering the relative cost of subclone sequencing reactions. Put the following in .consedrc consed.autoFinishCostOfCustomPrimerSubcloneReaction: 20 And then run autofinish again: ../../consed -autofinish -ace autofinish.fasta.screen.ace.1 Check that it now says: consed.autoFinishCostOfCustomPrimerSubcloneReaction: 20 near the top of the autofinish output file. You will notice that there are now 4 custom primer experiments and 2 universal primer experiments. AUTOFINISH: CHANGING MELTING TEMPERATURES 58) Look near the top of the autofinish output file and you will see the following lines: consed.primersMinMeltingTemp: 50 consed.primersMaxMeltingTemp: 55 Some labs prefer to use primers with higher melting temperatures. In your .consedrc file, put the following lines: consed.primersMinMeltingTemp: 55 consed.primersMaxMeltingTemp: 60 Then run autofinish again: Check that it now says: consed.primersMinMeltingTemp: 55 consed.primersMaxMeltingTemp: 60 near the top of the autofinish output file. Compare the first experiment from the last 2 autofinish runs. Everything should be the same except that the primers are longer at their 3' ends but are otherwise the same primers. AUTOFINISH: OTHER CONTROL 59) Try adding to .consedrc the following: consed.autoFinishCloseGaps: false and run autofinish again. What happened? Another parameter that people sometimes change is: consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.1 One finisher says that she prefers to set this at 0.5 errors and to decrease: consed.autoFinishMaxAcceptableErrorsPerMegabase: 1 This has the effect of making autofinish try to resolve every region where errors are clustered tightly together, even if the total error rate for the entire BAC is very low. You can change any of the parameters listed at the top of the autofinish output file (or actually any of the more exhaustive list of resources listed in the 'Info' menu, 'Show Consed Resources' list.) We believe the defaults are an excellent starting point. AUTOFINISH: NOT REPEATING FAILED EXPERIMENTS 60) If you are serious about doing the experiments autofinish suggests, consed -ace (ace file name) -autofinish -doExperiments -doExperiments causes autofinish to record its suggestions in the ace file. If one of these suggested reads fails to fix a problem, when autofinish is run again it won't pick the same read again. If a forward or reverse universal primer read failed, autofinish (when run in a subsequent round) will not suggest that same experiment. If a custom primer read fails, autofinish will not pick that same experiment again, and it won't pick a custom primer read that is even close to the failed one. 'Close' is defined by the resource: consed.autoFinishNewCustomPrimerReadThisFarFromOldCustomPrimerRead: 50 You can change the default of 50 if you like. In addition, autofinish (the next time it is run) will tell you how well each experiment did in solving the problem it was intended to solve. See the EVALUATING EXPERIMENTS section of the autofinish output file. (Note to programmers: the format of the autoFinishExp tags is likely to change--parse them at your peril!) -doExperiments will also cause oligos to be tagged. (You can turn this off by setting: consed.autoFinishTagOligosWhenDoExperiments: false Primer id's created by autofinish use the same naming scheme as primers created in consed and they will not conflict with each other. For example, if autofinish creates oligos djs14.1, djs14.2, and djs14.3, then the next primer that a user accepts will be djs14.4. If autofinish is run a second time, it will start with primer djs14.5. You should not type '-doExperiments' if you do not intend to do the experiments autofinish suggests. If you use -doExperiments, but you don't really do the experiments, and then you run autofinish again, autofinish will be very upset--it will think that all of its suggested experiments failed (because it can't find them). It will see that all of the problems are still present but it will think that it should not choose any of those same experiments again so it will suggest different experiments that will not be as ideal. AUTOFINISH: doNotFinish particular regions 61) If there is a region that you don't care to finish (e.g., it has already been finished or you know there is no gene there), then you can put a doNotFinish tag on the consensus and autofinish will not try to finish this area. Try putting a doNotFinish tag on the region from 1 to 200. Run autofinish again. You will notice that there will no longer be any experiments to solve weak regions in the consensus. ---------------------------------------------------------------------------- ADVANCED PHRAP/CONSED USAGE 62) BACKING OUT EDITS AFTER YOU HAVE SAVED THE ASSEMBLY If you decide that all your edits are terrible and you want to start over (perhaps you have been training a new finisher), the cleanest solution is to delete everything in phd_dir and edit_dir , but leave everything in chromat_dir and just run phredPhrap again. 63) SELECTIVELY BACKING OUT EDITS AND REMOVING READS If you want to back out all edits in just particular reads, I have provided a perl script to do this: revertToUneditedRead (read name) What it does it copy the .phd.1 to 1 greater than the highest version. Then you must reassemble using the phredPhrap script to create an ace file that has no edits for that particular read. It will have all edits for all other reads. Why doesn't it just delete all phd files except for the .phd.1? In that case, consed could not read any previous ace file since all previous versions of ace files would refer to phd files that have been deleted. 64) REMOVING READS FROM AN ASSEMBLY Create a file containing the filename of all the reads you want to remove, one filename per line. Then use the perl script removeReads Then reassemble using the phredPhrap script. 65) ADDING READS WITHOUT CHROMATOGRAM FILES This may happen if you, for example, download sequence from Genbank and want to assemble it along with your reads. There are 2 ways to do this, depending on whether you want to edit the read or not. a) If you want to edit the read, run mktrace to produce a fake trace. It will have all perfect peaks. Run: mktrace (name of file with fasta sequence) Then run the phredPhrap script normally. You will be able to bring up the traces in consed and edit the read. b) If it is not important to edit the reads, there is a method that is a little faster. Create just a fake phd file using: fasta2Phd.perl (name of file with fasta sequence) It will create a file whose name is taken from the fasta file name: for example, if the fasta filename is Contig1.c.fasta, then the phd file will be called Contig1.c.phd.1 The fasta name in the file is ignored. You can then put this in the phd_dir, and reassemble using the phredPhrap script. Note: all fake reads should end with an extension .c or .a or .c1 or .c2 ... or .a1 or .a2 or ... This is important because it tells consed and autofinish that this data cannot be used as a template for a primer. Note: when you are creating phd files such as this, you must start with (read name).phd.1 Do not start with (read name).phd.2 or any higher version number. This is because consed looks for the .1 version in order to find the original phred calls so it expects there to be a .1 version. If the reads are really fake (you don't want templates 66) WHY ARE ALL THE READS NOT IN THE ASSEMBLY? You will notice that there are some contigs that contain only one read. You will also notice that there are some reads that are not shown by consed at all, since phrap did not put them into the ace file. Why? If a read does not have a significant match (with Smith-Waterman score exceeding minscore) to any other read, that read is not included in the ace file. Instead, that read is put in the '.singlets' file. That read will not appear in consed. If a read does have a significant match to any other read, then it will appear in the ace file and be shown by consed. However, such a read might have other problems: it might not be possible to assemble such a read with other reads (in the case of EST's this read may be a unique representative of a particular gene (or a genomic sequence contaminant) that happens to contain an Alu repeat and thus happens to match other reads in the data set; or it may represent the only read of a particular alternatively spliced form; or it may have data anomalies of some sort (chimeras, etc.). Such a read would end up in a contig all of its own. 67) VIEWING THE CHROMATOGRAM OF SINGLETS OR NON-ASSEMBLED READS If you have a chromatogram, you can use consed to view it, even if it hasn't been assembled into the ace file. This is common with cDNA assemblies in which the reads don't overlap and thus phrap doesn't put them together into a contig. To do this, make the same edit_dir, phd_dir, and chromat_dir as above, put the chromatogram into chromat_dir, run phred on it to generate the phd file which goes into phd_dir. Then go to edit_dir and run: phd2Ace.perl (name of phd file) For example, if your phd file is myRead.phd.1 from edit_dir, type: phd2Ace.perl myRead.phd.1 This will produce myRead.ace Then just start consed normally: consed -ace myRead.ace and you can view the chromatogram. MULTIPLE TRACE POPUP 68) Bring up dataset standard. In the Aligned Reads window, scroll to a region that has many reads and that has some discrepancies--try position 1162. Hold down the shift key, and click with the middle mouse button on the consensus. At this location 3 traces will popup--these are the 2 highest quality traces that agree with the consensus (on each strand) and the highest quality trace that disagrees with the consensus. This feature is useful in areas of high coverage when you want to rapidly examine just the most significant traces rather than looking at all of them. MAXIMUM NUMBER OF TRACES DISPLAYED 69) Bring up dataset standard. Scroll to position 1162. Bring up 4 reads and then try bringing up additional reads.You will notice that new reads are put at the top of the stack of traces and, once there are 4 traces displayed, traces are automatically removed from the bottom of the stack. If you want to change this maximum number of traces to something besides 4, you can do that: In the Main Consed Window (click on 'Find Main Win' on the Aligned Reads window), pull down the 'Options' menu, and release on 'General Preferences'. Try changing the 'Max Number of Traces Shown' to 3. Then click 'Apply and Dismiss'. Now dismiss the Trace Window and again start adding additional traces to the Trace Window. You will notice that now the number of traces shown will not exceed 3. HOTKEYS FOR EDITING 70) If you do a lot of editing, you will want to have a faster method of doing these edits than having the popup and selecting an option. Thus the following hot keys exist: < and > (less than and greater than) to make n's to the left and the right (respectively) of the cursor control-l and control-r to make low quality to the left and the right (respectively) of the cursor overstriking with a capital letter (e.g., C instead of c) causes the base to become high quality rather than low quality overstriking with a lower case letter causes the base to become low quality Give these a try. 71) Now go to the menu labelled 'color', and pulldown and release on 'color means match'. Now you notice different colors: The colors have the following meaning: Blue: agrees with consensus Orange: disagrees with consensus Yellow: this stretch of this read was used to form the consensus Grey: Low quality or unaligned ends of reads Now go back to the colormode 'color means quality and tags' (the default) for the next exercise. (The other colormodes will mean more to you later.) ALPHABETICAL ORDERING OF READS 72) The reads can be ordered in two ways: a) alphabetically b) first all the top strand reads and then all the bottom strand reads. The top strand reads are then ordered by the left end of the reads. Same with the bottom strand reads. Try changing between a) and b). In the Main Consed Window (click on 'Find Main Win' on the Aligned Reads Window if you can't find the Main Consed Window because it is covered up with other windows), pull down the 'Options' menu, and release on 'General Preferences'. Find 'Display reads sorted alphabetically or by strand/left end of read.' Switch it between 'alpha' and 'strand'. Then click 'Apply and Dismiss'. Notice the effect in the Aligned Reads Window. Many polymorphism and mutation detection labs find that alphabetically sorting is most useful, while many genomic sequencing labs find that sorting by strand/left end of read is most useful. SCROLLING TRACES INDEPENDENTLY 73) Dismiss all of your Trace Windows. Then popup traces for 2 different reads in approximately the same location. Scroll one of them. You may want to scroll by clicking the arrows or clicking to the left or right of the thumb. You will notice that both will scroll. Consed will do its best to have corresponding peak lined up. (Consed can't line all of them up because the peak spacing is not uniform and differs from read to read.) Try removing a trace by clicking on one of the 'Remove' buttons in the Trace Window. Try adding other traces. Then click on 'No' for scrolling the traces together and try scrolling. You will now observe that they scroll separately. ABI BASE CALLS 74) If you want to see the ABI base calls, no problem. Just go to the Main Consed Window. Pull down the 'Options' menu and release on 'General Preferences'. Click on 'True' for 'Show ABI Bases in Trace Window' and then click 'OK' at the bottom of the window. The ABI bases will not be shown immediately--you must first dismiss the trace window and bring it up again. You will then see an additional line with the ABI base calls. MEASURING ERROR RATE AND SINGLE SUBCLONE BASES FOR A REGION 75) Some contigs have long tails of low quality bases and you would like to find out the error rate for the contig without that long tail. On the Align Reads Window, pull down the Misc menu, and release on 'Show Errors for a Region'. This will tell you both the error rate for the region and the number of single subclone bases for that region. ------------------------------------------------------------------------ INSTALLING CONSED You MUST have the following phred, phrap, phd2fasta, and crossmatch in order to use this version of consed: 0.980904.e or later for phred (0.980904.a, b, or c is not adequate) 0.990319 or later for phrap and crossmatch 0.990622.d or later for phd2fasta (supplied with this version of consed) For phred, contact bge@u.washington.edu (Brent Ewing) For phrap and crossmatch, contact phg@u.washington.edu (Phil Green) In order to run the gauntlet of phred/phd2fasta/crossmatch/phrap, there is a perl script phredPhrap supplied with consed (above). YOU MUST USE THIS PERL SCRIPT. If you try to run each of these programs directly, you are on your own and you will probably fail. Consed used to use .Xdefaults for consed parameters--no longer. Now consed uses ~/.consedrc for most of the same parameters. Thus you should remove consed parameters from .Xdefaults and put them in .consedrc in your home directory. Before, when you made a typo with one of the consed parameters, it was just silently ignored. Now consed makes a big fuss. So you need to be prepared to find out all of the parameters that have not been working all this time. To start with, type: cd ~ touch .consedrc That will create a new empty consed parameter directory. You can add lines to it as you need to customize consed. Although most consed parameters now go into .consedrc, there are still a very few that need to stay in .Xdefaults. Here is the rule: if the parameter starts with consed. such as consed.gunzipFullPath: /bin/uncompress then it goes into .consedrc If the parameter starts with consed* such as consed*contigwin.background: Black then it goes in .Xdefaults You can also make such customizations system-wide (for everyone) or for just a specific project. See CONSED CUSTOMIZATION (below) for more information. 76) Follow the first few steps of USING CONSED GRAPHICALLY of the Quick Tour (above). If you have problems, it may be due to your X emulator. See 'MONITORS FOR CONSED' below. 77) The default locations for most of consed, phred, and phrap require that there be a directory /usr/local/genome I strongly suggest you make such a location--it will save you many headaches of trying to customize scripts for other locations. If you can't actually use /usr/local/genome, then you could make /usr/local/genome be a link to the real location--that will work just as well. 78) Make sure that /usr/local/genome/bin is in every consed users' PATH. 79) Put the consed executable in /usr/local/genome/bin 80) Check this by logging on as a user and typing: consed -V You should see 'Version 9.0'. If you see something else, you have some debugging to do. 81) Build phd2fasta: Go to the misc/phd2fasta directory and type 'make' Move the phd2fasta executable to /usr/local/genome/bin 82) Build mktrace: Got to the misc/mktrace/980701 directory and type 'make' Move the mktrace executable to /usr/local/genome/bin 83) Move all perl scripts from the scripts directory to /usr/local/genome/bin Make sure all are executable (chmod a+x *) DELETE ANY PREVIOUS VERSIONS OF THESE SCRIPTS OR YOU WILL BE SORRY! (Bugs have been fixed.) 84) Get perl 5. You can check where to get perl via the perl web site: http://www.perl.com/perl/info/software.html (If you don't know about perl, try it--it will save you a huge amount of time over developing the same utilities in C, awk, or csh or sh.) 85) From the misc subdirectory, copy primerCloneScreen.seq and primerSubcloneScreen.seq to the directory /usr/local/genome/lib/screenLibs (You may have to create this directory.) Take a look at these files. They are dummy files indicating the fasta format of the sequences that should be put in them. You should put into primerCloneScreen.seq the vector sequence of the cloning vectors you are using (BAC or cosmid) and into primerSubcloneScreen.seq the sequencing vectors you are using (plasmid, M13, etc). Don't be too generous in putting lots of vectors into the files! The larger they are, the slower primer picking will be. Our files are only this big: -rw-r--r-- 1 root root 29938 Nov 7 1997 primerCloneScreen.seq -rw-r--r-- 1 root root 7381 Aug 13 1997 primerSubcloneScreen.seq and primer picking is quite fast enough. Now that you have set this up, you should try the PRIMER PICKING sections in the Quick Tour (above) to make sure this works. Note that you should *not* do the temporary step in the beginning of PRIMER PICKING. That is because you want the primers screened against vector. 86) You should also create a file /usr/local/genome/lib/screenLibs/vector.seq This contains all the vector that you want to mask out before phrapping. In general, it is the combination of primerCloneScreen.seq and primerSubcloneScreen.seq 87) You should also create a file /usr/local/genome/lib/screenLibs/repeats.fasta In this file, put any repeats that you want to have automatically tagged. These typically are ALU sequences. If you don't want to tag anything, then comment out (put '#' as the first character of the line) the following lines in phredPhrap: Change: !system( \"$tagRepeats $szAceFileToBeProduced\" ) || die \"some problem running $tagRepeats\"; to: #!system( \"$tagRepeats $szAceFileToBeProduced\" ) # || die \"some problem running $tagRepeats\"; 88) determineReadTypes.perl Phrap, Consed's primer picking, and Consed/Autofinish all need the following information for each read: is it a univeral primer forward, a universal primer reverse, or a walking read? what is its template name? Generally this information can be determined from the read name, using *your* naming convention. Modify the perl script determineReadTypes.perl to put this information at the end of the phd file using WR info items. Consed allows you to check that you have correctly modified determineReadTypes.perl: On the Main Consed Window, point to 'Info', hold down the left mouse button, and release on 'Show Info for Each Read'. Check that the information presented is correct. If, for example, consed thinks that there are templates that have 9 or more reads, it is likely that you have not correctly customized determineReadTypes.perl Once you have correctly customized determineReadTypes.perl, then uncomment the line in phredPhrap which calls determineReadTypes.perl TEST RUNNING PHREDPHRAP 89) See the section RUNNING PHRED and PHRAP in the Quick Tour (above) TESTING ADDING NEW READS 90) It will make your life easier if phred, phrap, and crossmatch are all where consed expects them: in /usr/local/genome/bin 91) Decide where to put phred's parameter file and edit both addReads2Consed.perl and phredPhrap to reflect this location. I generally prefer to put it in /usr/local/genome/lib to keep all of the phred/phrap/consed files in one place. Alternatively, you could put it in /usr/local/etc/PhredPar/phredpar.dat which is the historical location of this file. 92) Next you should test the ADDING NEW READS step in the Quick Tour (above). This step requires that everything be set up correctly and in the correct location. Hopefully the error messages are clear enough to help you if you have set up anything incorrectly. USING YOUR OWN DATA 93) Create the following directory structure: Directory structure: top level directory (generally named after the BAC or cosmid) subdirectory 'chromat_dir'--chromatograms go in here subdirectory 'phd_dir'--phd files will automatically be put here subdirectory 'edit_dir'--ace files will automatically be put here If you already have your chromatograms somewhere else, you can make chromat_dir be a link to wherever you have them. The various phrap and crossmatch files will be put into edit_dir by the phredPhrap script. 94) cd to the edit_dir directory, and type: phredPhrap If you are successful, the script will tell you so and you can bring up consed on the ace file: 95) Type: consed You should see a file with the extension .ace.1 Double click on it. You should see a list of contigs. Double click on the one you want to see. Follow the first few steps of the Quick Tour under USING CONSED GRAPHICALLY (above). You should at least go as far as viewing traces. 96) Appending expid to the phd files If you are using autofinish, and would like autofinish to tell you how well your reads are succeeding, then the phd files must be appended with the experiment id's. In the 3 autofinish summary files (*.univReverse, *.univForwards, and *.customPrimers), you will see information like this: univ rev,,,->,-329,-249,71,Contig1,3,djs228_1034 or this: tgaagaaatggctgactcc,56,1,->,3258,3338,3658,Contig1,4,djs228_2813,5,djs228_168,6,djs228_1248 The '3' just before the djs228_1034 is an experiment id. There is also an expid '4' just before djs228_2813, an expid '5' before djs228_168, and an expid '6' just before djs228_1248. Autofinish doesn't know what you will end up calling these reads it is telling you to make. Autofinish only knows those reads by the numbers 3, 4, 5, and 6. So when you make the reads, autofinish needs to be informed that this is 'experiment 3' or whatever. You do this by appending in the phd file the following structure: WR{ expid addExpid 990811:140818 5 } where WR stands for 'whole read item', expid for 'expid' addExpid is the name of the program that you will write that will append this information 990811:140818 is the date and time in format YYMMDD:HHMISS 5 is the expid This program must be run *after* phred runs to create the phd files. Thus your program must have some method of determining what the expid of each read is. What the University of Washington Genome Center does is to have the finishers put the expid as part of the filename. This makes it easy for a program to look at the phd file and figure out what the expid is and then write the WR item into that phd file. Alternatively, you could keep a database and, after the phd file is created, look into the database to see what the expid is. When you have successfully added expid's to the phd files, the next time you run autofinish on this project, it will have in the 'EVALUATE' section of the autofinish output file, lots of interesting information about how well the reads succeeded. USING NON-STANDARD LOCATIONS FOR FILES You have a lot of work to do. You will need to edit nearly every script mentioned above. In addition, you will need to make sure that the CONSED_PARAMETERS environment variable is set for every user and that the CONSED_PARAMETERS file points to the new locations for these files: consed.primersSubcloneFullPathnameOfFileOfSequencesForScreening: /usr/local/genome/lib/screenLibs/primerSubcloneScreen.seq consed.primersCloneFullPathnameOfFileOfSequencesForScreening: /usr/local/genome/lib/screenLibs/primerCloneScreen.seq consed.primersBadTemplatesFile: badTemplates.txt consed.fullPathnameOfAddReads2ConsedScript: /usr/local/genome/bin/addReads2Consed.perl consed.fullPathnameOfCrossMatch: /usr/local/genome/bin/cross_match consed.fullPathnameOfPhred: /usr/local/genome/bin/phred As you can see, sticking with the default of /usr/local/genome will make your life easier--not just at installation, but even in day to day operations. (Remember--/usr/local/genome could be just a link) -------------------------------------------------------------------------- NOTE TO SGI USERS In /usr/lib, there must be a file: libCsup.so If you don't have this file, you must get it from SGI. To get it, if you are on Irix 6.2 through 6.4, request: SG0001637 'C++ Exception handling patch for 7.00 (and above) compilers on irix 6.2' (it's on the 'Development Options 7.1' CD). If you are on Irix 5.3, install patch 1600 To make things easier for you, I've included my libCsup.so This might save you having to get the patches above. ---------------------------------------------------------------------------- FOR PROGRAMMERS AND FELLOW TRAVELLERS ONLY CONSED VERSION On the command line, type: consed -v This is particularly useful to system administrators to make sure the latest version is installed on all computers. CONSED CUSTOMIZATION Click on the 'Info' menu on the Main Consed Window and release on menu item 'Show Consed Resources'. This shows you what is available to be changed by putting in your ~/.consedrc file. Changes in ~/.consedrc only affect one user. If you want to make a change to affect all consed users on the system, put a file in some central location (e.g., /usr/local/genome/lib/.consedrc ) and then have every user set the environment variable CONSED_PARAMETERS to that location: setenv CONSED_PARAMETERS /usr/local/genome/bli/.consedrc Anything the user puts in ~/.consedrc will override whatever is in the CONSED_PARAMETERS file. You can also have different parameters for different projects. Put a .consedrc file in the edit_dir of a particular project. When you are working on that project, whatever is in that .consedrc will override whatever is in your ~/.consedrc file or the CONSED_PARAMETERS file. COMPRESSING CHROMATOGRAMS If you are interested in compressing your chromatogram files, go into chromat_dir and gzip one of the chromatogram files. Make sure that gunzip is in /usr/local/bin (You can change this location via the consed resource consed.gunzipFullPath: /usr/local/bin/gunzip --see CONSED CUSTOMIZATION (above), but it will be easiest for you and your users if you just put gunzip in /usr/local/bin and not have to bother with consed resources.) Restart consed and bring up the corresponding trace. You will notice no appreciable delay. CONSED -ACE Try bringing up consed like this: consed -ace (name of ace file) This can be useful if you are going to have consed brought up from some other program. NO PHD FILES Try bring up consed like this: consed -nophd This mode does not allow editing and does not show quality information. It allows you to view an assembly when you don't have phd files or chromatograms but you only have the ace file. You will not be able to see the quality information, since that information is kept in the phd files. I do not recommend nor support this option! CREATING CUSTOM TAG TYPES The following consed resources are available for creating custom tag types: consed.tagColorCustomTag1: consed.tagColorCustomTag2: consed.tagColorCustomTag3: consed.tagColorCustomTag4: consed.tagColorCustomTag5: consed.tagColorCustomTag6: consed.tagColorCustomTag7: consed.tagColorCustomTag8: consed.tagColorCustomTag9: consed.tagColorCustomTag10: consed.tagColorCustomTag11: consed.tagColorCustomTag12: consed.tagColorCustomTag13: consed.tagColorCustomTag14: consed.tagColorCustomTag15: consed.customTag1: consed.customTag2: consed.customTag3: consed.customTag4: consed.customTag5: consed.customTag6: consed.customTag7: consed.customTag8: consed.customTag9: consed.customTag10: consed.customTag11: consed.customTag12: consed.customTag13: consed.customTag14: consed.customTag15: consed.tagColorCustomConsensusTag1: consed.tagColorCustomConsensusTag2: consed.tagColorCustomConsensusTag3: consed.tagColorCustomConsensusTag4: consed.tagColorCustomConsensusTag5: consed.tagColorCustomConsensusTag6: consed.tagColorCustomConsensusTag7: consed.tagColorCustomConsensusTag8: consed.tagColorCustomConsensusTag9: consed.tagColorCustomConsensusTag10: consed.tagColorCustomConsensusTag11: consed.tagColorCustomConsensusTag12: consed.tagColorCustomConsensusTag13: consed.tagColorCustomConsensusTag14: consed.tagColorCustomConsensusTag15: consed.customConsensusTag1: consed.customConsensusTag2: consed.customConsensusTag3: consed.customConsensusTag4: consed.customConsensusTag5: consed.customConsensusTag6: consed.customConsensusTag7: consed.customConsensusTag8: consed.customConsensusTag9: consed.customConsensusTag10: consed.customConsensusTag11: consed.customConsensusTag12: consed.customConsensusTag13: consed.customConsensusTag14: consed.customConsensusTag15: When you create a custom tag type, you specify its name and the color you want it displayed in. For example: consed.tagColorCustomTag1: SlateBlue2 consed.tagColorCustomTag2: SlateBlue2 consed.tagColorCustomTag3: SlateBlue2 consed.tagColorCustomTag4: brown consed.tagColorCustomTag5: MediumPurple consed.tagColorCustomTag6: purple consed.customTag1: polymorphismInsertion consed.customTag2: polymorphismDeletion consed.customTag3: polymorphismSubstitution consed.customTag4: qualityCoreComment consed.customTag5: coordinatorApproval consed.customTag6: coordinatorComment (All of these tag types are read tag types. Consensus tag types are specified separately--see the consed resource names (above).) Once you have done this, the user of consed can add tags of these types in the method described in TAGS of the Quick Tour (above). ADDING TAGS FROM OTHER PROGRAMS You can also write external programs that add tags to the ace file and/or the phd files. Both RT (read) and CT (consensus) tags can be appended to the end of the ace file. BEGIN_TAG tags can be appended to the end of the phd files. Do not rewrite the ace file or the phd file--there is no need to do so and it will cause problems. CONTROL OF CONSED FROM SOME OTHER PROGRAM Consed can be controlled by some other program. For example, you might have a program that displays mapping data and you would like the user to be able to click on a location and have consed come up showing the bases in that region. This feature allows a programmer to do this. The external program can start up consed as follows: consed -socket (local port number) -ace (ace filename) For example, consed -socket 5432 -ace standard.fasta.screen.ace After consed completes coming up (including you clicking whether you want to apply edits), you will see the message in the xterm: success bind to local port number: 5432 And then you will see a file created by consed in the default directory called consedSocketLocalPortNumber This gives the port number of the Berkeley socket that consed has opened and is listening on. Thus your program can read this file and create a connection to the Berkeley socket created by consed. Once the connection is established, your program can send commands to consed at that socket indicating to consed which contig to display and what consensus position to scroll to. Currently, the only acceptable commands are: Scroll (contigname) (consensus position) PopupTraces (read name) (unpadded read position in the direction of sequencing) 'Unpadded read position in the direction of sequencing' is the position from the right end, if the read is a bottom strand read. Just send such a command to the Berkeley socket, and consed will respond appropriately. AUTOMATIC ORDERING OF OLIGOS I heard of a finisher who manually ordered 72 oligos. She had to cut/paste the bases of each oligo. That is not only painful, but also error prone. I've supplied you a script that you can use to automatically determine which oligos have been newly requested since the last order, aggregate them into a single order, and email the request off. The script is ace2Oligos.perl. It takes as parameters the name of an ace file and the name of the oligo file. The oligo file is a list of oligos that have been ordered for that particular project, and looks like this: name=G1980A181.1 sequence=ctgcatggctaggga template=seq from subclone date=980427 temp=52 name=G1980A181.2 sequence=tcttactttctgactttcattt template=seq from clone date=980427 temp=50 ace2Oligos.perl finds all oligo tags in the ace file and makes sure that all of them are in this oligo file. To automatically order oligos each night, there is an additional script you will have to write. I suggest that you run your script each night under cron and that it do the following: for each project, it will look for the most recent ace file. It will run ace2Oligos.perl on that ace file and direct the oligo file to be in the parent directory of edit_dir, phd_dir, and chromat_dir for that project. Thus there will be one oligos file for each project. Your script will run ace2Oligos.perl once for each project. Then your script would, for each project, look in the oligos file for new oligos, and aggregate the unordered oligos into a central file, which it would email to the oligo company. If it finds any new oligos in an oligo file, it draws a line at the bottom: ------------------------------- which indicates that all oligos have been ordered. When this script looks at this file the next night, it uses this line to determine whether any additional oligos have been requested since the previous order. (The idea of this line came from St Louis.) Thus the oligos file tells you which oligos have been ordered and which have not yet been ordered. 97) CUSTOM NAVIGATION In the Main Window, there is also a Navigate menu. Pull it down and release on the Custom Navigation menu item. A box will popup saying 'Select custom navigation file:' There will be a file: custom_navigation.nav Double click on it. You will see the now-familiar custom navigation box. Click 'Next' repeatedly until you get to the end of the list. Consed doesn't write such a file--it just reads it. This feature allows you the ability to write your own programs that select locations that you want your finishers to examine. Your program writes a file, the user reads that file into consed in this manner, and you can go to each of the locations. 98) LONG, LONG, LONG READ NAMES If you have very long read names, you might not be able to see the whole name in the Aligned Reads Window. You can solve this by increasing the consed resource: consed.alignedReadsWindowMaxCharsForReadNames: 20 -------------------------------------------------------------------------- MONITORS AND MICE FOR CONSED If your monitor is part of a Unix computer (a Sun, an HP, a DEC, an SGI, or a Linux box) or is an Xterminal, then you will have absolutely no problems. You must have 3 button mouse or 3 button emulation. 3 Button emulation is tricky since consed uses all 3 buttons of the mouse and it also uses Control-Middle-Mouse-button, Shift-Middle-Mouse-Button and Control-Right-Mouse-Button. So if you are going to try to just use a 2 button mouse (or, God-forbid, a 1 button mouse), you should make sure that you can emulate each of those. Often, if you push the left and right mouse buttons at the same time, your X server will interpret that to be the middle mouse button. But you must consult your X emulator or X server to know what it will do--that is out of consed's control. If your monitor is a PC running Windows or NT, then you must have an X emulator installed and running. X emulators include: Exceed, XWin32, Reflection X, and OpenNT. Any of these will work if configured correctly (and the 'correctly' is the key). I encourage you to use single window mode and then use a Unix window manager such as CDE, fvwm, or mwm. If your monitor is a MAC, then you must also have an X emulator, such as Exodus or MACX installed and running. You *must* use this emulator in single window mode, and then use a Unix window manager such as CDE, fvwm, or mwm. (If you don't use single window mode, consed might crash in some circumstances.) -------------------------------------------------------------------------- PRIMER PICKING PARAMETERS The following are primer picking resources. Many are used for both consed and autofinish. There are some that are just used for autofinish and some that are just used for consed. A great deal of science and experimentation has gone into setting these defaults and I suggest you do not change them until you have experimented and know what you are doing. You can set these via the .consedrc file. In addition, for a particular consed session, you interactively change many of these in the following manner: On the main window, point to 'Options', hold down the left mouse button and release on 'Primer Picking Preferences.' You can modify the resource of interest and then click on 'Apply and Dismiss'. The new value of the resource will be in affect only until you restart consed. In the following, I have annotated the parameters with the following symbols: (YES) freely customize to your own site (OK) don't change unless you have a specific need and know what you are doing (NO) don't change this! This is what they mean (I suggest you skip over this for now): consed.primersAssumeTemplatesAreDoubleStrandedUnlessSpecified: false bool ! you can put the template type in the phd file in a WR template item ! consed will have a list of these and know which are single and ! double stranded (YES) consed.primersLookThisFarForForwardVectorInsertJunction: 125 int ! don't change this--if no X's this far from beginning of read, then ! assume that you are in insert (NO) consed.primersMinimumLengthOfAPrimer: 15 int (YES) consed.primersMaximumLengthOfAPrimer: 25 int (YES) consed.primersALittleLessThanAverageInsertSizeOfASubclone: 1500 int // for finding templates ! used to calculate extent of a template for choosing templates (YES) consed.primersMaxInsertSizeOfASubclone: 3000 int // for checking for false-annealing ! check +/- this distance from the primer for false-annealing (YES) consed.primersDNAConcentrationNanomolar: 50.0 double ! used for melting temperature--don't change this! Consed uses the nearest-neighbor (with salt concentration correction) formula, just as all modern primer picking programs do (NO) consed.primersMaxMatchElsewhereScore: 17 int ! used for testing false-annealing to template and to vector In choosing a primer, it is important that the primer not stick somewhere besides the place you are trying to get a read--a 'false match'. This can cause a primer to fail even if the false match is not perfect. The worst kind of false matches are those the extend to the 3' end of the primer, and worse yet if they have a high percentage of G/C matches since G and C bind more tightly than A and T. The algorithm used here takes both of these effects into account. This parameter sets the max acceptable false match. In practice, it is this parameter that eliminates most primers. You can get consed to give you some primers by raising this parameter, but if you do, you should be aware of the danger of mispriming. To make you aware of that danger, you can do this: when you choose a primer (see above for how to do this), look in the xterm. It will show you the best alignment of each primer with some other location in the assembly. By looking at this you will gain an idea of what the PrimersMaxMatchElsewhereScore means and you won't be too free about raising it above the default. (OK) consed.primersMaxMeltingTemp: 55 int (YES) consed.primersMaxSelfMatchScore: 6 int ! cutoff for self-annealing of a primer In choosing a primer, you don't want the primer to bind to itself (form a hairpin) or bind to another copy of itself. It is particularly bad if it binds to another copy at its 3' end. This parameter is used in the algorithm that tests this. (OK) consed.primersMinMeltingTemp: 50 int (YES) consed.primersMinQuality: 30 int ! you must be sure of the sequence of a primer or it won't anneal to where you want Some primers fail because the primers don't match where they are supposed to. This is because the sequence where the primer is supposed to stick isn't accurately known. Thus it is important to be certain of the sequence where the primer is chosen from. This parameter is an indication of this certainty--it is the min quality of every base in an acceptable primer. (NO) consed.primersNumberOfBasesToBackUpToStartLooking: 50 int Consed is designed for you to put the cursor on the left-most (or right-most) edge of a region that you want to cover with a new read. Since the data quality immediately after an oligo is not good, you don't want the oligo immediately next to the region you want to cover, but rather a little bit back from it. This parameter gives how far back. e.g., if this is 50 and you want a read at position 1000, primers will be searched before base 950 but not in the region 950 to 1000 This parameter is not used for autofinish--just for consed. (OK) consed.primersNumberOfTemplatesToDisplayInFront: 2 int ! this shows the number of templates to show in the interactive primer picking window (OK) consed.primersPickTemplatesForPrimers: false bool ! when picking primers for subclone templates, pick templates also. ! If there is no suitable template for a primer, do not pick the ! primer. If you like to pick your own templates, you might want to ! turn this off for a little improvement in speed. (YES) consed.primersPrintInfoOnRejectedTemplates: true bool ! whether to print which templates were rejected and why (this output can be large ) (OK) consed.primersSaltConcentrationMillimolar: 50.0 double ! used for melting temperature--don't change this! (NO) consed.primersSubcloneFullPathnameOfFileOfSequencesForScreening: /usr/local/genome/lib/screenLibs/primerSubcloneScreen.seq RWCString ! vector sequence file if choosing subclone (e.g., M13, plastmid) templates (OK) consed.primersCloneFullPathnameOfFileOfSequencesForScreening: /usr/local/genome/lib/screenLibs/primerCloneScreen.seq RWCString ! vector sequence file if choosing clone (e.g., cosmid, BAC) template (OK) consed.primersScreenForVector: true bool ! whether or not to screen primers for annealing to vector It is important that the primers not stick to the vector of the template. Thus you must provide consed with two files--a file in fasta format of all subclone vectors, and a file in fasta format of all clone vectors. Consed will not accept any primer that has a match against the appropriate one of these vectors (depending on whether you are choosing primers for clone template or from subclone template). A primer that has a false match to a vector is rejected if that false match has a score worse than PrimersMaxMatchElsewhereScore (OK) consed.primersMaxLengthOfMononucleotideRepeat: 4 int Finishers have seen that primers with mononucleotide repeats fail more often. This parameter says that a primer with AAAA is acceptable but AAAAA is not. (OK) consed.primersBadTemplatesFile: badTemplates.txt FileName ! file of templates that you've tried, don't work, and you don't want to try again (OK) consed.primersToleranceForDifferentBeginningLocationOfUniversalPrimerReads: 100 int ! different forward reads or different reverse reads ! can differ by up to this amount in the starting location ! If they differ by more, then there is something wrong ! with the template (it is mislabeled?) so don't use it again for walking (NO) consed.primersTooManyVectorBasesInWalkingRead: 10 int ! if there are this many x's, then don't walk again on this template (OK) consed.primersWhenChoosingATemplateMinPotentialReadLength: 500 int ! when choosing templates for a custom primer, only choose a template ! if the read can be chosen at least this long This currently can only be set via your .consedrc file. It is used in picking templates for a primer. Clearly you don't want a template to end too soon after the primer. This parameter indicates the minimum number of bases that a template must extend after the primer location. (OK) consed.primersWindowSizeInLooking: 450 int This is the width of the region in which consed looks for primers. So if PrimersNumberOfBasesToBackupToStartLooking is 50 and PrimersWindowSizeInLooking is 450, and you are looking for a forward primer, then the consed will look from 500 bases to the left of the cursor up to 50 bases to the left of the cursor. If you are looking for a reverse primer, then consed will start looking 50 bases to the right of the cursor and continue until 500 bases to the right of the cursor. (OK) You can also read about this in the consed paper: Gordon, D., C. Abajian, and P. Green. 1998. Consed: A graphical tool for sequence finishing. Genome Research. 8:195-202 -------------------------------------------------------------------------- AUTOFINISH PARAMETERS Autofinish uses many of the primer picking parameters. Autofinish also has additional parameters. In the following, I have annotated the parameters with the following symbols: (YES) freely customize to your own site (OK) don't change unless you have a specific need and know what you are doing (NO) don't change this! bool means the value must be true or false int means the value must be an integer double means the value must be a decimal number consed.autoFinishAllowWholeCloneReads: true bool A 'whole clone read' as opposed to a 'subclone read' is when the sequencing template for the sequencing reaction is the entire assembly. If you are assembling a BAC, a whole clone read is one that is sequenced directly off the BAC. If the assembly is a full length cDNA, then a whole clone read is one in which the sequencing reaction is off a complete cDNA. This resource tells autofinish that it is ok to suggest whole clone reads. entire clone (BAC or cosmid). If you don't want to use the whole BAC as a template for any reads, change to false. (YES) consed.autoFinishAverageInsertSize: 1500 int used for calling reverses. This determines the location of the potential reverse read. If you have a forward read already, autofinish uses this number as an estimate of how far away the beginning of the reverse read should end up. (YES) consed.autoFinishCallReversesToFlankGaps: true bool If there is a forward-reverse pair flanking a gap, print it out If there is not, suggest reverses to flank the gap. Useful to help align and orient the contigs. (YES) consed.autoFinishCallHowManyReversesToFlankGaps: 2 int How many forward/reverse pairs must flank a gap. If there are fewer than this number, autofinish will try to suggest more reverses to do. If there are already this number or more forward/reverse pairs, it will list them and not suggest any more. (YES) consed.autoFinishCloseGaps: true bool This allows you to turn off choosing reads to close gaps. For example, if you choose to close all gaps by PCRs using manually-picked primers, you should change this to false. (YES) Cost Parameters: consed.autoFinishCostOfResequencingUniversalPrimerSubcloneReaction: 20.0 consed.autoFinishCostOfCustomPrimerSubcloneReaction: 60.0 consed.autoFinishCostOfCustomPrimerCloneReaction: 80.0 consed.autoFinishCostOfDeNovoUniversalPrimerSubcloneReaction: 60.0 double (YES) Compares universal primer subclone resequencing reaction, universal primer subclone denovo reaction (a reverse where you just have a forward or a forward where you just have a reverse), custom primer subclone reaction, custom primer clone reaction, and to decide which to favor. These parameters give you control over which type of reactions autofinish prefers when it has a choice. The default costs have been chosen by Seattle and St Louis. They reflect the fact that ordering an oligo is more expensive than using a universal primer. They also reflect the fact that whole clone reactions (sequencing off the BAC) are more difficult to do than subclone reactions (sequencing off the plasmid). consed.autoFinishCoverSingleSubcloneRegions: true bool ! this allows you to turn off choosing reads to cover single subclone regions (YES) consed.autoFinishCoverLowConsensusQualityRegions: true bool ! this allows you to turn off choosing reads to cover low consensus quality regions (YES) consed.autoFinishCreateExpSummaryFiles: true bool ! this allow you to turn off creating the 3 experiment summary files: forward universal primer, reverse universal primer, and custom primers (OK) consed.autoFinishDoNotFinishWhereTheseTagsAre: doNotFinish RWCString list of tag types separated by spaces. E.g., doNotFinish repeat tells autofinish that you are not interested in finishing in this region (OK) consed.autoFinishDumpTemplates: false bool ! for debugging, this allows you to dump all information about the templates--insert locations (OK) consed.autoFinishExcludeContigIfOnlyThisManyReadsOrLess: 2 int ! exclude contigs that are probably E. coli contamination (OK) consed.autoFinishExcludeContigIfDepthOfCoverageOutOfLine: true bool (OK) consed.autoFinishExcludeContigIfDepthOfCoverageThisMuchMoreThanLargestContig: 2.0 double ! exclude contig if its depth of coverage is much greater than other ! contigs (this indicates contamination) (NO) consed.autoFinishHowManyTemplatesYouIntendToUseForCustomPrimerSubcloneReactions: 2 int ! this tells autofinish which templates you are planning on using which is necessary to figure out which regions will still be single subclone regions (YES) consed.autoFinishMaxAcceptableErrorsPerMegabase: 100 int ! target error rate (YES) consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.1 double ! if an experiment solves fewer errors than this, it isn't worth doing so won't be chosen, even if the target error rate has not yet been achieved (OK) consed.autoFinishMinNumberOfForwardReversePairsToCalculateAverageInsertSize: 100 int ! if there are fewer forward/reverse pairs than this, then the parameter ! consed.autoFinishAverageInsertSize is used instead. These parameters are ! when calling reverses to figure out where the reverse should go (NO) consed.autoFinishMinNumberOfGapErrorsFixedByAGapClosingExp: 30 int (NO) consed.autoFinishNewCustomPrimerReadThisFarFromOldCustomPrimerRead: 50 int ! this tells autofinish when it wants to make a new custom primer read, how far this read must be from any previous custom primer reads on the same strand (NO) consed.autoFinishLookForRepeatedForwardUniversalPrimerReadThisFarAway: 200 int ! this tells autofinish how far to look for the tag of a previously called universal primer read (NO) consed.autoFinishNumberOfGapClosingReadsPerContigEnd: 3 int ! don't make any more experiments than this to extend into a gap (YES) consed.autoFinishMinNumberOfSingleSubcloneBasesFixedByAnExp: 1 int ! if an experiment will only fix less than this number of single subclone bases, don't do it even if the total number of single subclone bases in the contig is too high (OK) consed.autoFinishNumberOfBasesBetweenContigsAssumed: 200 int ! gap size--each base in the gap counts as 1 error so autofinish tries to extend into gaps (NO) consed.autoFinishPotentialHighQualityPartOfReadStart: 80 int This is how far the high quality region of the read is from the beginning of the read. (OK) consed.autoFinishPotentialHighQualityPartOfReadEnd: 300 int -------------------------------------------- ^ ^ ^ beginning A B of read <-----------------> consed.autoFinishPotentialHighQualityPartOfReadStart <-------------------------------> consed.autoFinishPotentialHighQualityPartOfReadEnd You can adjust these depending on your assessment of the typical quality of your data. (OK) consed.autoFinishReversesForFlankingGapsTemplateMustProtrudeFromContigThisMuch: 100 int ! we don't want these templates in which it goes into vector right at ! the end of the template (OK) consed.autoFinishTagOligosWhenDoExperiments: true bool ! when autofinish is run with -doExperiments, tags the oligos ! it chooses (OK) consed.autoFinishTryHarderToSuggestExperimentsToCoverLowQualityRegions: true bool ! consed tries to cover a low quality region with a read of a different strand ! or chemistry from the existing reads covering that area. If it can't find ! any read of a different strand or chemistry, should it suggest a read of ! the same strand and chemistry as an existing read? This parameter says \"yes\". (OK) ---------------------------------------------------------------------------- NEW ACE FILE FORMAT There is a new ace file format (since early 1998). If you still haven't changed to the new ace file format, you must do so now since it contains information that is not contained in the old ace file format. This additional information (e.g., the alignment and quality clipping values) are essential for some of the consed functions (e.g., navigate by single stranded, navigate by single subclone, autofinish) to work correctly. Another reason to switch to the new ace format is that you will get faster consed startup performance. The new ace file format is also much smaller (about 60% as big as the old). The new phrap (Aug 1998 and better) writes the new ace format (using the -new_ace switch). Since consed now uses the additional information found only in the new ace format, if you are editing an assembly, you should first re-phrap to take advantage of this additional information. Consed can read either old or new ace format. Consed can also write either new or old ace format. It write the new ace format by default--see 'Options'/'General Preferences'. Also see the consed resource: consed.writeThisAceFormat: 2 (where 2 means 'new' and 1 means 'old') If you have scripts that read the ace file, you will need to modify those scripts for the new ace format. Here is the format: Ace File Format Refer to the accompanying sample_ace_file.txt (below) AS CO <# of bases> <# of reads in contig> <# of base segments in contig> The U or C indicates whether the contig has been complemented from the way phrap originally created it. Thus this is always U for an ace file created by phrap. BQ This starts the list of base qualities for the unpadded consensus bases. The contig is the one from the previous CO, hence no name is needed here. AF This line replaces the 'AssembledFrom*' line in the previous ace file format. C or U means complemented or uncomplemented. The is the true read name (no .comp on it as with the previous ace file format.) BS This replaces the 'BaseSegment*' line from the previous ace file format. RD <# of padded bases> <# of whole read info items> <# of read tags> QA This is new information not found in the previous ace file. If the entire read is low quality, then and will both be -1. These positions are offsets from the left end of the read (left, as shown in consed). Hence for bottom strand reads, the offsets are from the end of the read. The offsets are 1-based. That is, if the left-most base is in the aligned, high-quality region, = 1 and = 1 (not zero). DS CHROMAT_FILE: PHD_FILE: TIME: CHEM: DYE: TEMPLATE: